Flanders-Flemish DNA Project

Tutorial

Introduction to Genetic Genealogy

(sample page from Flemish DNA & Ancestry)

The human genome contains about 3.2 billion chemical bases or nucleotides. These chemicals define each human being and provide a blueprint for life. These chemicals are adenine, guanine, cytosine, and thymine, commonly abbreviated as A, G, C, T. These chemicals always combine in a certain way: C always pairs with G, and A always pairs with T. Pairs of AT or CG are arranged in a long spiral, a coiled thread structure, like a double stranded helix. DNA is the sequence of these combinations of chemicals. Simply put this spiral coil looks like a ladder that is twisted.

A gene is a specific section of this long double-stranded helix of DNA. Thousands of genes make up a chromosome: 46 of them are arranged in 23 pairs of which only one pair defines the gender. It is the 23rd pair of chromosomes that contains the sex chromosomes. The 46 chromosomes contain approximately 30,000 genes.

Each human cell that contains DNA has a cell nucleus and a membrane. Between the genes on all the chromosomes there are many areas that do not code for proteins. These areas are odd bits and pieces that are not proper coding parts. Outside the nucleus but still within the cell membrane (in the cytoplasm) is the mitochondrial DNA (mtDNA).

Each human cell has several hundred to thousands of mitochondria. These mitochondria are the providers of energy for the cell. Muscle or brain cells have more mitochondria than the liver or lung cells.

In each mitochondrion, there are between two and ten copies of mtDNA. A mature egg when fertilized contains about 100,000 mitochondria, each containing its usual number of copies of mtDNA (usually one to ten). When fertilized the sperm will contribute about 50 mitochondria, which provide energy for the sperm tail to the egg. A sperm has about 50 mitochondria, mostly to be found in the tail, but on fertilization the tail falls off and no male mitochondria enters the egg, at least not under normal circumstances. Hence only the mtDNA from a mother is passed to her offspring. Thus mtDNA is handed down by every mother to all of her children.

The small amount of non-nuclear DNA found in each mitochondrion, is a circular piece of genome with about 16,569 nucleotides. Hence the DNA outside the nucleus of each human cell is quite different from the DNA in the nucleus that contains 3.2 billion pairs of chemicals and is arranged in a long spiral coil or double stranded helix.

The ring of non-nuclear mitochondrial DNA is divided in regions. There are two hyper-variable regions labeled HVR-1 and HVR-2 (plus to be complete:13 genes coding for proteins, 2 genes to produce ribosomal proteins, and 22 transfer RNA genes, each relating to a specific amino acid). The HVR-1 region goes from position 16024 to 16383 and contains 359 base pairs (bps); the HVR-2 region goes from position 00057 to 00372 and contains 315 bps. The entire spectrum is called the D-loop or Control Region and contains 917 bps. All the rest of this circular genome is a coding region. The Figure on the right provides a graphic representation of the structure of mtDNA.

A typically basic mtDNA test yields a standardized result of 400 base pairs (out of 917 bps) that are compared to a DNA standard, the CRS. The result of a typical mtDNA test that includes the HVR-1 and HVR-2 regions can yield a few base pairs that differ from this standard. The more differences there are with the standard the farther back in time the tested mtDNA would have split from the base of the genetic tree. The maternal haplogroup is determined from this basic mtDNA test.

Figure mtDNA circle shows the Structure of mtDNA containing about 16,569 base pairs. In this figure two regions are labeled HVS-I and HVS-II; these correspond with the HVR-1 and HVR-2 referred to in the text (Source: Doron M. Behar, 3rd International Conference on GG, November 2006.

The non-nuclear DNA present in the mitochondria has nothing to do with the X-chromosome of females. An egg from a woman contains 22 autosomal chromosomes and one X-chromosome. All children receive an X-chromosome from their mother; additionally, daughters receive an X-chromosome from their father. Hence, sons receive a Y-chromosome from their father and an X-chromosome from their mother (YX). The Y chromosome can be used to trace the exclusively male line of a family. Daughters receive an X-chromosome from each of their parents (XX).

When a cell divides, all of the DNA in it replicates. Occasionally a mutation occurs during the replication process, so that the DNA copy is slightly different from the original. There are two types of mutations: point mutations and short tandem repeats.

Point mutations are one-letter changes in DNA segments. For example, if CTTCAGGGTC...is a segment of DNA and if one mutation occurs so that it becomes CTTCAGGGCC...(notice the change in the next to last letter), then this is called a Single Nucleotide Polymorphism or SNP (pronounced "snip"). Y chromosome SNPs have a slow mutation rate and produce low resolution haplogroups. Mitrochondrial SNPs have a fast mutation rate and produce high resolution haplotypes. SNPs are used to plot the phylogenetic tree that shows the relationship of all current human haplogroups to the original ancestor who walked out of Africa. Each mutation creates another sub branch of the tree of the phylogenetic tree.

Short tandem repeats are the repeating segments in a DNA segment. For example, when Y-chromosome DNA test looks at a small number of markers it may find

CTTCTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTAG

where starting from the fifth letter there are 12 repeats of TAGA, before hitting TCCTAG. The repeating patterns that occur in DNA are Short Tandem Repeats (STRs). Hence since this DNA string shows 12 repeats of TAGA, the allele value that would be recorded for the specific marker for this DNA sample string would be 12. The same process of counting repeating patterns is applied to other markers.

At any single STR location, it is estimated that a mutation will occur only once every 500 transmission-events or roughly 0.2% per generation. Basically, a transmission event is the birth of a baby boy, but it is also an event where a mutation can occur and be passed on. The rate of this genetic clock is still under debate (some STRs) will change more rapidly than others and more research needs to be done in that area, but overall 0.2% per generation is a good working estimate.

In the past, DNA testing for the Y chromosome focused on only 12 markers; more details can be obtained from testing more markers, e.g., 25, 37 or 67 markers. It is however wise to start off with testing for just 12 markers; if 10 or more markers match then upgrading to 25 or 37 markers may be desirable.

STRs have the fastest mutation rates, are characterized by multi-state characters and produce high resolution haplotypes. With the increase in the number of markers tested, the observed number of mutations will go up accordingly. Using 37 markers, one can expect to see a mutation once every 13 transmission events. (i.e. 500 / 37 markers = ~13).